★ Free online encyclopedia. Did you know? page 358

Nucleic acid structure prediction

Prediction of structure of nucleic acids is a computational method for determining secondary and tertiary structure of nucleic acids from its sequence. Secondary structure can be predicted from one or more nucleic acid sequences. Tertiary structu ...

Nussinov plots

RNA and tRNA, as a rule, has a complex two-dimensional structure. Ruth Nussinov realized that there is a simple way of detecting the structure of RNA and tRNA. The technique is to create a circle. Each base is numbered. If there is a "base n", th ...

Partition function for Interacting RNAs

Partition function for interacting RNAS-parallel C package to compute joint and individual partition functions for two RNA sequences. From the functions section, Pirna calculate the equilibrium concentrations of single and double species, ensembl ...

Piwi-interacting RNA

Piwi-interacting RNA is the largest class of small non-coding RNA molecules expressed in animal cells. pirnas form RNA-protein complexes through interactions with Piwi-subfamily argonaute proteins. These Pirna complexes are mainly involved in epi ...

Preribosomal RNA

Preribosomal RNA is a small class of RNA that are copied from DNA representing the genome sequence. However, the pre-rRNA cannot be used for the production of proteins before its introns are splicing takes place, forming new relationships between ...

Pseudoknot

In a pseudoknot is a nucleic acid secondary structure containing at least two stem-loop structures in which half of one stem is inserted between the two halves of another stem. In the pseudoknot was first recognized in the turnip yellow mosaic vi ...

Pseudomonas sRNA

Pseudomonas Srna are non-coding RNAS that were predicted SRNApredict2 program bioinformatics. This program determines the estimated sRNAs to search for co-localization of genetic features commonly associated with Srna-encoding genes and the expre ...

Purine riboswitch

The purine riboswitch is a sequence of ribonucleotides in the specific messenger RNA that selectively binds to the purine ligands using a natural aptamer domain. This binding causes a conformational change in the mRNA that may affect the translat ...

Ribonucleotide

In biochemistry, in ribonucleotide is a nucleotide that contains ribose as its pentango component. He is a molecular precursor of nucleic acids. Nucleotides are the basic building blocks of DNA and RNA. The monomer from ribonucleotides forms the ...

Riboregulator

In molecular biology, riboregulator is RNA that responds to a signal nucleic acid molecule Watson-Crick pairing bases. In the riboregulator can react with a molecule signal in any number of ways, including the translation of RNA into protein, act ...

Riboswitch

In molecular biology, a riboswitch is a regulatory segment of the RNA molecule that binds a small molecule, which leads to a change in the production of the proteins encoded by the mRNA. Thus, mRNA that contains a riboswitch is directly involved ...

RNA hydrolysis

RNA hydrolysis is a reaction in which fosfolipidnyh bonds in the Sugar-phosphate backbone of RNA is broken, cleaving the RNA molecule. RNA is susceptible to this base-catalyzed hydrolysis, because the ribose sugar in RNA has a hydroxyl group in p ...

RNA transfection

RNA transfection-the process of deliberately introducing RNA into a living cell. RNA can be purified from cells after lysis or synthesized from free nucleotides either chemically or enzymatically using RNA polymerase in DNA transcription. Like DN ...

RNA-induced silencing complex

RNA-induced silencing complex, or RISC, is a multiprotein complex, in particular ribonucleoprotein which consists of one strand of a single stranded fragment of RNA, such as microRNA, or double stranded siRNAs. In single Strand acts as a template ...

RNAs present in environmental samples

A wide selection of non-coding RNAS have been identified in different species of organisms known to science. However, RNA was discovered in the "metagenomics" of the sequences obtained from DNA or RNA extracted from the environment, which contain ...

RsaOG

RsaOG is a non-coding RNA that was discovered in the pathogenic bacteria Staphylococcus aureus N315 using a large-scale computational screening based on phylogenetic profiles. It was first identified, but not named, in 2005. RsaOG have since been ...

SbRNA

sbRNA family of non-coding RNA first discovered in the nematode Caenorhabditis elegans. It was detected in the entire screen of the transcriptome cDNA library C. elegans. Subsequent experiments characterized by sbRNA saved as 5 and 3 internal mot ...

Short hairpin RNA

Short hairpin RNA or small hairpin RNA is an artificial molecule of RNA with a tight hairpin bend which can be used to silence target gene expression via RNA interference. Expression of shRNA in cells is typically accomplished by delivery of plas ...

Small nucleolar RNA-derived microRNA

In molecular biology, small nucleolar RNA derived microRNA are derived from small nucleolar RNAS. MicroRNAs, as a rule, derived from precursors known as pre-miRNAs, these pre-miRNAs are recognized and cleaved from the Pri-microRNA precursor and P ...

SR1 RNA

In molecular biology, RNA SR1-a small RNA produced by species of Bacillus and closely related bacteria. This is a dual function RNA that acts as a protein-coding RNA and regulatory Srna. RNA ИР1 involved in the regulation of arginine catabolism. ...

SRNA-Xcc1

Srna-Xcc1 family of TRANS-acting non-coding RNA. Homologs of Srna-Xcc1 are a few bacterial strains belonging to alpha-proteobacteria, beta-proteobacteria, gamma-proteobacteria, and Delta proteobacteria. In Hapag of campestris PV. field, Srna-Xcc1 ...

Streptococcus sRNA

In molecular biology, Streptococcus sRNAs are small RNA produced by bacteria Streptococcus. Several screens had identified numerous sRNAs in different species and strains of streptococci, including S. pneumoniae and S. pyogenes and S. agalactiae, ...

Subgenomic mRNA

During transcription, the original template strand is usually read from the 3 to the 5 end from the beginning to the end. Subgenomic mRNAs are created when transcription begins at the 3 end of the template strand, or 5 to be newly synthesized and ...

T7 RNA polymerase

The organizer is to bind and initiate transcription. The consensus T7 and related phages: 5’ * 3 T7 TAATACGACTCACTATAGGGAGA T3 AATTAACCCTCACTAAAGGGAGA K11 AATTAGGGCACACTATAGGGAGA SP6 ATTTACGACACACTATAGAAGAA bind------------ -----------init Transc ...

TeloSII ncRNAs

TeloSII non-coding RNA was detected by choosing the body and element shall contain a sequence in the genome-wide screening in Arabidopsis. These elements were shown to coordinate the expression of protein-coding genes associated with ribosomal bi ...

Tobacco mosaic virus memory

Tobacco mosaic virus is an extremely common helical virus, with a positive semantic of the RNA chain. In recent years, the researchers found that this virus can be used to create nano wires using platinum nanoparticles. Tseng et al. found that by ...

Trypanosome H/ACA box snoRNAs

Non-coding RNAS are RNA molecules that have function, but are not translated into proteins. Small nucleolar RNAS, one of the largest classes of ncrnas, in turn, are divided into two major C / D and H families / ACA snornas. snornas serve as guide ...

Ure2 internal ribosome entry site (IRES)

In molecular biology, the site of internal entry of ribosomes Ure2 is an RNA element present in the 5 UTR of the mRNA Ure2. This allows 5 cap - and eIF4E-independent translation N-terminally truncated form of the Ure2. This truncated form lacks t ...

Vibrio cholerae ToxT activated RNAs

In molecular biology, Vibrio cholerae ToxT-activated RNA small RNA that are produced by the bacteria Vibrio cholerae. They are regulated at the transcriptional activator ToxT and may play a role in the virulence of V. cholerae. Two ToxT-activated ...

VR-RNA

In molecular biology, BP-RNA-small RNA produced by Clostridium filters. It functions as a regulator of two-component VirR / VIRS system. VR-RNA regulates numerous genes, including: Extracellular nucleases kada. (Внеклеточные нуклеазы када) The ge ...

Xanthomonas sRNA

In molecular biology, Hapag Srna small RNA that have been identified in various species of bacteria of Hapag. Analysis of plant pathogen of Hapag of campestris PV. vesicatoria revealed expression of the seven CIS-encoded antisense RNAS asX1-asX7 ...

Z-RNA

Z-RNA-alternative left-handed conformation for the RNA double helix. As for Z-DNA, z-RNA are often selected sequence consists of the purine / pyrimidine repeats, especially the CG repeats.

Cymodoceaceae

Cymodoceaceae is a family of flowering plants, sometimes known as the "manatee-grass family", which includes only marine species. In 2016 APG IV does not recognize Cymodoceaceae and places it in the order Alismatales, in the treasure monocots. Th ...

Thalassodendron ciliatum

Thalassodendron ciliatum is widely distributed in the Indo-Pacific region, but also variable numbers throughout their range. This algae recorded at the Western Philippines, Borneo, and Singapore, Indonesia, Papua New Guinea, the Caroline Islands, ...

Halophila

Halophila is a genus of algae, in the family Hydrocharitaceae, the tape-grasses. It was described as a genus in 1806. The number of its contained species, and its own place in the order Alismatales, has evolved. It is widely distributed in tropic ...

Halophila engelmannii

Halophila engelmannii, commonly known as star grass and Engelmanns of algae, a flowering plant, and algae in the family Hydrocharitaceae. It grows underwater on sandy or muddy sea bottom in shallow part of the Gulf of Mexico and Caribbean sea.

Posidonia

Posidonia is a genus of flowering plants. It contains nine species of marine plants found in the seas of the Mediterranean and around the South coast of Australia. The 1998 APG system and the APG II system of 2003 to recognize this genus as the o ...

Posidonia robertsoniae

A type of algae, submerged flowering plants found in the mediterraean climate. Perennial rhizomatous herb that appears as is in the marine habitat. This species occurs at depths from 0.5 metres to 20 metres on white sand, in coastal waters, which ...

Zosteraceae

Zosteraceae is a family of marine perennial flowering plants found in temperate and subtropical coastal waters, with the highest diversity located around Korea and Japan. Most marine algae complete their life cycle under water, the pollen is fila ...

Encyclopedic dictionary

Translation
Free and no ads
no need to download or install

Pino - logical board game which is based on tactics and strategy. In general this is a remix of chess, checkers and corners. The game develops imagination, concentration, teaches how to solve tasks, plan their own actions and of course to think logically. It does not matter how much pieces you have, the main thing is how they are placement!

online intellectual game →